| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.067125 |
| Chromosome: | chromosome 8 |
| Location: | 1409563 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g364351 | FAL12 | Protein of unknown function; (1 of 3) 2.4.1.68 - Glycoprotein 6-alpha-L-fucosyltransferase / Guanosine diphosphofucose-glycoprotein fucosyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTCTCGGGCTTGGGGAACAGCAGGTAGTTGACGGCGCAGCCGAAGGCG |
| Internal bar code: | AGTCAAGAAAATATATCCTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 208 |
| LEAP-Seq percent confirming: | 77.7778 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGGAGGGGAGGGAAG |
| Suggested primer 2: | TTGGATGGGATGAAAGGGCC |