| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.067128 |
| Chromosome: | chromosome 6 |
| Location: | 8743133 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310700 | RPL36A,RPL36a,RPL41 | Ribosomal protein L36a; (1 of 1) K02929 - large subunit ribosomal protein L44e (RP-L44e, RPL44) | 3'UTR |
| Cre06.g310750 | COPG1 | (1 of 1) K17267 - coatomer protein complex, subunit gamma (COPG); Gamma subunit of COP-I complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCTATCCCAACATTCCTAAGTGATTACTCCCCTGCTACAATCCCAGTG |
| Internal bar code: | CAAGGAGATTAGGTCGCATCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5103 |
| LEAP-Seq percent confirming: | 48.5149 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 101 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGTGTATGAGACCGGGG |
| Suggested primer 2: | CCCATGAGTCGTGTGTCACA |