| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.067140 |
| Chromosome: | chromosome 6 |
| Location: | 6090115 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g290950 | RPS5 | (1 of 1) K02989 - small subunit ribosomal protein S5e (RP-S5e, RPS5); Cytosolic 80S ribosomal protein S5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTTCGTCAGCATGCAGCTTCAACCGCTGGACGTAACTCTGATGCAGTT |
| Internal bar code: | GGGTCACTCGCCGCCGCAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1170 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACGGAACATCGAAGCTT |
| Suggested primer 2: | CTAAAGGAGCAGCAGCAGGT |