| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.067175 |
| Chromosome: | chromosome 5 |
| Location: | 3525183 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g233600 | DIV55 | [RNA-polymerase]-subunit kinase / CTD kinase; (1 of 13) 2.7.11.23 - [RNA-polymerase]-subunit kinase / CTD kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTTGCAACCTGCCAGTTGCTTTCTAAGAATTAGAAGCCTGTTGTTGT |
| Internal bar code: | ACCGATGAAACGAACAGATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 267 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCTAGGTGGCATTCGTT |
| Suggested primer 2: | AGTTCAACGGTTTTCGCTGC |