Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.067196 |
Chromosome: | chromosome 6 |
Location: | 6269980 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g292400 | SOUL5 | (1 of 8) PF10184 - Uncharacterized conserved protein (DUF2358) (DUF2358); DUF2358 domain protein | 3'UTR |
Cre06.g292450 | PUS13 | RNA pseudouridine synthase; (1 of 1) 5.4.99.44 - Mitochondrial tRNA pseudouridine(27/28) synthase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACACTGCCGTGTCGTTGTGCCACCAAGTGCACCACTGGGGACACCCCC |
Internal bar code: | AGTCCACTAGGTAAGGTTGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3056 |
LEAP-Seq percent confirming: | 93.5065 |
LEAP-Seq n confirming: | 72 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGTGTACGGACGCGAAGA |
Suggested primer 2: | TTCGGCTTCAGGTCTTGGTC |