Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.067235 |
Chromosome: | chromosome 12 |
Location: | 5645002 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g531600 | EIF5Bd | (1 of 1) K13690 - alpha-1,3-mannosyltransferase [EC:2.4.1.-] Man a1-3 Man (CMT1); putative translation initiation factor eIF-2 beta chain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAATGCTGCCTACGCCAGCGCCAGTATCTTGCATCCATTCTGTGCCAGA |
Internal bar code: | TTCCGGACGCCTAGTTCGAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 357 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTGGAGTTCGTGCGCAAA |
Suggested primer 2: | AACCACCATCAGGCCAAGAG |