| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.067314 |
| Chromosome: | chromosome 13 |
| Location: | 2211507 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g578150 | RRAA1,RRA1 | Regulator of ribonuclease activity A; (1 of 1) 4.1.1.3 - Oxaloacetate decarboxylase / Oxaloacetate carboxy-lyase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAACACTTGGAATACAACATGAAGCTTATTATATCATTAGGTTGACGT |
| Internal bar code: | TTGGCTCAGTGACACTTGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4137 |
| LEAP-Seq percent confirming: | 97.2222 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATATGTGCATGTGCCCTGC |
| Suggested primer 2: | CTCAAGTCCAGCAAGCGAGA |