Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.067335 |
Chromosome: | chromosome 2 |
Location: | 6964613 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389282 | PF6-IP3,C1a-32,FAP114 | (1 of 2) PF14769 - Flagellar C1a complex subunit C1a-32 (CLAMP); Coiled-Coil Flagellar Associated Protein 114 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTAACCGGGGGCATTGGGGCACGAGCCGCAGCACGCGCCAGAGCCTCA |
Internal bar code: | TGTTAACCCGATGCTTTCTCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4025 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 41 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCTGCTTCCCTCTTCCAG |
Suggested primer 2: | CACGTCTGGGGTGCATTACT |