| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.067338 |
| Chromosome: | chromosome 3 |
| Location: | 2582570 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160150 | (1 of 35) IPR016135 - Ubiquitin-conjugating enzyme/RWD-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGAATGGTCCAGTCTAAGCCCGCCTTTGCCGGTGGCCAGCTCTGGTAGT |
| Internal bar code: | GTGTGAGCGATAACAGCCAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 7116 |
| LEAP-Seq percent confirming: | 98.9691 |
| LEAP-Seq n confirming: | 96 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 97 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTGTAGTTGCGCCAGTGC |
| Suggested primer 2: | ATGTCTTATCCTGGGGGCCT |