| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.067361 |
| Chromosome: | chromosome 17 |
| Location: | 4582260 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g732000 | ATP9A | (1 of 2) K02128 - F-type H+-transporting ATPase subunit c (ATPeF0C, ATP5G, ATP9); Mitochondrial F1F0 ATP synthase subunit 9, isoform A | 3'UTR |
| Cre17.g732050 | AGE3 | DNA repair glycosylase; (1 of 1) K10773 - endonuclease III (NTH) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAGAGCCGCAGCGCACCTGCAGGAGGCTGTACATACGGTACCAGGCG |
| Internal bar code: | GGGTCAAGGTCGTACAAGGGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3102 |
| LEAP-Seq percent confirming: | 92.3913 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 92 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGACAGAACACGTGGTGC |
| Suggested primer 2: | AGGTGAAGTGAAGACTGCGG |