| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.067455 |
| Chromosome: | chromosome 1 |
| Location: | 8075696 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g063267 | BLP1 | Bystin-like protein; (1 of 1) K14797 - essential nuclear protein 1 (ENP1, BYSL) | 3'UTR |
| Cre01.g063632 | (1 of 1) K03660 - N-glycosylase/DNA lyase (OGG1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTGAACCACATCCTTGTGCCTATTTACTGCAATAACACATCCATCGA |
| Internal bar code: | GCAGTTGCAACTGAAGGTCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 426 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGGAGGACTGAGAGGGG |
| Suggested primer 2: | ATGAGGGTTCATGTGGCTGG |