| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.067470 |
| Chromosome: | plastome |
| Location: | 29182 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802278 | 2717059,rpl5,ChreCp016 | 50S ribosomal protein L5; (1 of 2) PF00673 - ribosomal L5P family C-terminus (Ribosomal_L5_C) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAGATCGTTTAATTCATTTAGCATTACCGCGTGTACGCGATTTCCAAG |
| Internal bar code: | GGTATAATACAATTATTCTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 330 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACTGACGTCCACTACAA |
| Suggested primer 2: | TCGGGGGATATGCTTTGCAA |