| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.067548 |
| Chromosome: | chromosome 12 |
| Location: | 5822297 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533050 | (1 of 1) K14538 - nuclear GTP-binding protein (NUG1, GNL3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTGTTAGACACTGCCGCTTGTTTGTTGTAGCTGCAGAATGCTATGCTG |
| Internal bar code: | GTCCGCTCTGGGCAATTGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1692 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATTACTGGGGCGGGTCTA |
| Suggested primer 2: | GACAGCGATGATGAGGAGGG |