| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.067561 |
| Chromosome: | chromosome 17 |
| Location: | 5054090 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g736150 | POL1C,POL1-2 | DNA polymerase I, probably mitochondrial; (1 of 5) PTHR10133 - DNA POLYMERASE I | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGTGCAGGCGTGTGTACCCCACCCTCAACCAAGTGGGCACTGCCACG |
| Internal bar code: | AGGGGTCGACAATCAATTCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 347 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCCAAACTCCTCCTTGTC |
| Suggested primer 2: | CTGCCGACAATGCCGTTATG |