| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.067606 |
| Chromosome: | chromosome 14 |
| Location: | 4150220 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g634100 | (1 of 7) IPR010995 - DNA repair Rad51/transcription factor NusA, alpha-helical | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCGCCCGGTCCCGGCCTGCACGTTTTTCGCGTACCCGCGCCTCGGAT |
| Internal bar code: | CAACTATCTGTTGGTCACGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2148 |
| LEAP-Seq percent confirming: | 28.5714 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTGCCGGTGAGATAGTGGA |
| Suggested primer 2: | CAGCGCCGCTAAGAAATTCC |