| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.067619 |
| Chromosome: | chromosome 2 |
| Location: | 491369 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076300 | UROD2,UPD2 | Uroporphyrinogen-III decarboxylase; (1 of 1) PTHR21091:SF105 - UROPORPHYRINOGEN DECARBOXYLASE 1, CHLOROPLASTIC | 3'UTR |
| Cre02.g076350 | ATPVB1,ATPVB | Vacuolar ATP synthase subunit B; (1 of 1) K02147 - V-type H+-transporting ATPase subunit B (ATPeV1B, ATP6B) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACTGCTTAGCGCGTCAGTCGAAGGAAACCGGAAACGTATCCGGTGTA |
| Internal bar code: | AGCGTCGTGGCGCACGTCGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4579 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCTTAACACGCTTCCCCC |
| Suggested primer 2: | GTAGCCTCAAATCCCCTCCG |