| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.067685 |
| Chromosome: | chromosome 7 |
| Location: | 2639229 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330450 | uL24m,MRPL24 | Mitochondrial ribosomal protein L24; (1 of 2) K02895 - large subunit ribosomal protein L24 (RP-L24, MRPL24, rplX) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAGTTGGTGCTTACCACCTTGCAAGGCAGGGCTACGGAACTGCTCTCA |
| Internal bar code: | TAGGCGTGTACTCTGCCCCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 148 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAGCCTCTGTATCGGAG |
| Suggested primer 2: | GCTGTATGCACCTGTGGACT |