| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.067694 |
| Chromosome: | chromosome 10 |
| Location: | 6744054 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g467000 | IFT55,IFT57 | (1 of 1) K04638 - estrogen-related receptor beta like 1 (ESRRBL1, HIPPI); Intraflagellar Transport Protein 57 | 5'UTR |
| Cre10.g467050 | MOT48,DAP2,IDA10,DNAA14 | (1 of 3) PF08190 - pre-RNA processing PIH1/Nop17 (PIH1); Inner Arm Dynein assembly factor | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCAGGAGGAGGACGCCTCAGTCCTAAGCTTCTCTTCTATTAGTTAG |
| Internal bar code: | GAGGTCGAGTATACCTGTCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 21009 |
| LEAP-Seq percent confirming: | 97.9167 |
| LEAP-Seq n confirming: | 94 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTTGTATCTGCGGGGCAT |
| Suggested primer 2: | GGCCCCCTCACCTTTAAGTC |