| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.067729 |
| Chromosome: | chromosome 13 |
| Location: | 3732516 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588550 | SYP1 | Plasma membrane Qa-SNARE, Syx1/Sso1/Syntaxin1/Syp1 family (Qa.IV); (1 of 1) K08486 - syntaxin 1B/2/3 (STX1B_2_3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTAGCTCGCTCATAAGCGGGTCAATGTCATCGGTAGCTACCCAAAACCG |
| Internal bar code: | GTTCCGAACGTTGCCGCGAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 938 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAAACCCCATCACCCCCAC |
| Suggested primer 2: | GACCTAAATGTCGCGTTCGC |