| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.067767 |
| Chromosome: | chromosome 1 |
| Location: | 3981706 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026100 | RPP14,XRP14 | (1 of 1) K03537 - ribonuclease P/MRP protein subunit POP5 (POP5); Ribonuclease MRP subunit P14 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCACGTCACTCGCCGCCAATCGACACGTGCACCCTCGGCCCCACGCCCT |
| Internal bar code: | TGAAGGGCAGGGCTTCAGCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2107 |
| LEAP-Seq percent confirming: | 93.0233 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTAGCATTGGGGCAAAGA |
| Suggested primer 2: | CCTACGGGACTTCACCAACC |