| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.067840 |
| Chromosome: | plastome |
| Location: | 58553 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802286 | ycf12 | proposed transmembrane component of photosystem II; (1 of 1) PF05969 - Photosystem II complex subunit Ycf12 (PSII_Ycf12) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATACTTCTTAATAACAAAGAAAAATTTTGTTCACAAACACACATTAA |
| Internal bar code: | GCCCGAAGTGGGGTAATTCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 184 |
| LEAP-Seq percent confirming: | 13.1148 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCGTAGCCAGACCACACA |
| Suggested primer 2: | ACACCAGAGCGTCCTTTCTG |