Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.067855 |
Chromosome: | chromosome 16 |
Location: | 2632935 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g661350 | RBCMT1,RMT1 | (1 of 1) K00592 - [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase (E2.1.1.127); ribulose-1%252C5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative | 3'UTR |
Cre16.g661400 | (1 of 1) PTHR22979 - ZINC FINGER PROTEIN-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTCAGATTTTCAGACATTGCACCGTGGCGTGGGGGCAGCCCACCTTTC |
Internal bar code: | GTATGTCCACGCGTACCTGATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1469 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAGTTCAAGTCGCTTGCGA |
Suggested primer 2: | TGGACGACGGTAAGTGTGTG |