Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.067859 |
Chromosome: | chromosome 7 |
Location: | 1045409 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g319750 | HEL35 | (1 of 1) K14807 - ATP-dependent RNA helicase DDX51/DBP6 [EC:3.6.4.13] (DDX51, DBP6); DEAD box ATP-dependent RNA helicase | 3'UTR |
Cre07.g319800 | (1 of 1) IPR000104//IPR009148 - Antifreeze protein, type I // Streptococcal non-M secreted SibA | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCAATCCGCACACATTGATTGAGTTCTGTACTTTGAGCGGCTTGCCG |
Internal bar code: | TGATTGTGTTATTGTGTAACAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1194 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCAGGAGACTCAACACCC |
Suggested primer 2: | GGGTGATAGTTGGTTGGCGA |