| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.067891 |
| Chromosome: | chromosome 10 |
| Location: | 2583268 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436700 | (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | 3'UTR | |
| Cre10.g436800 | (1 of 2) PF01833//PF07691//PF10162 - IPT/TIG domain (TIG) // PA14 domain (PA14) // G8 domain (G8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAACGAGATCAGGATGTATGTATGTGCGTGCGCGTGTGCGTACGTGTG |
| Internal bar code: | AAGAACATAACTTACAACGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2960 |
| LEAP-Seq percent confirming: | 99.0196 |
| LEAP-Seq n confirming: | 101 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 102 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTCCACTGGCAACGTCAG |
| Suggested primer 2: | ACGCTTGAAGCACGTACTGA |