| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.067964 |
| Chromosome: | plastome |
| Location: | 62338 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802290 | ChreCp026,2716975,psbM | photosystem II protein M; (1 of 1) K02714 - photosystem II PsbM protein (psbM) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTTATATTAGGACGCCAGTGGCAGTGGTACCGCCACTGCCTATTTTAA |
| Internal bar code: | TACTACAGTTACTTCGCTAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 382 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGAAGGAGAATGTTGCCC |
| Suggested primer 2: | ATGTGATGCCTCGCCTATCG |