| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.067968 |
| Chromosome: | chromosome 13 |
| Location: | 4988352 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g606000 | EFG7 | (1 of 1) PTHR23115//PTHR23115:SF14 - TRANSLATION FACTOR // ELONGATION FACTOR FAMILY PROTEIN; Putative organellar translation elongation factor EFG/EF2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCTTGTCTGCCCATCTGTAGCGCCTCCCCGACTGCCAGTACGGCATT |
| Internal bar code: | TTCAAGAACCACAATTGGACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3945 |
| LEAP-Seq percent confirming: | 13.7255 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTGGCGTCGAGGTATAC |
| Suggested primer 2: | CGGAGTTTTGCGCAACTTGA |