| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.067971 |
| Chromosome: | chromosome 14 |
| Location: | 571393 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611700 | PLAP8,PLP8 | Plastid lipid associated protein 8; (1 of 1) PF01476//PF04755 - LysM domain (LysM) // PAP_fibrillin (PAP_fibrillin) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGACGGGTGTCGCTCGTCGCTTGCCGCCTGGACAATGTTGCCAGGGGCG |
| Internal bar code: | AGAAGTCTTGCATCGGGGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2365 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGGAAGAAACGCGCTCA |
| Suggested primer 2: | AAGCATCTGAACGGAGGCAA |