Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.068007 |
Chromosome: | chromosome 10 |
Location: | 6188491 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g462816 | (1 of 2) IPR007112//IPR007117//IPR009009 - Expansin/pollen allergen, DPBB domain // Expansin, cellulose-binding-like domain // RlpA-like double-psi beta-barrel domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCTGATTGGCGGGACATCGGCGTGGGTCGGGTGGGGCGGCGCGGGTT |
Internal bar code: | GCAACAGATGTCCGGATGGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 66 |
LEAP-Seq percent confirming: | 45.4545 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCGGTAGGTCACATTCACA |
Suggested primer 2: | GACCCAAACGCCAACTTCAC |