Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.068040 |
Chromosome: | chromosome 2 |
Location: | 8327522 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g143151 | SPB | (1 of 5) PF04130 - Spc97 / Spc98 family (Spc97_Spc98); Spindle pole body component | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCAGCGCGCCATACAGGTGGTCCAGCAGGGCCGGGCCGCGCGGGAA |
Internal bar code: | AAATATTCATGCGAGGCGCGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 113 |
LEAP-Seq percent confirming: | 14.2857 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTGCGATGCCTGCAATTAG |
Suggested primer 2: | CCACACACACACACACACAC |