Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.068075 |
Chromosome: | chromosome 11 |
Location: | 2493552 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095110 | FAP255 | Flagellar Associated Protein 255; (1 of 1) K17553 - protein phosphatase 1 regulatory subunit 11 (PPP1R11) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGGGATGACGGTGACTCGCCCCGAGCAATATGTGCAATGTCAGATAG |
Internal bar code: | GTTGCCTCAGTTTATGGCGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2412 |
LEAP-Seq percent confirming: | 98.3607 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGGTCGAAGTCTATCCCG |
Suggested primer 2: | GTGCAGGAGGACAGGATAGC |