| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.068091 |
| Chromosome: | chromosome 9 |
| Location: | 3648194 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397068 | Cytochrome P450, CYP3 superfamily | 5'UTR | |
| Cre09.g397105 | (1 of 19) 1.14.14.1 - Unspecific monooxygenase / Xenobiotic monooxygenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGGCTTAGGTTTAGCTAGGCGGGGAACTTCGGGCCTTGGATCCAAGT |
| Internal bar code: | AAACAATTGCCCTATAAATTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2084 |
| LEAP-Seq percent confirming: | 96.5909 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGATGTTCTCCGTGTGCTT |
| Suggested primer 2: | AAAAATCCCAATGCCCGTGC |