Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.068140 |
Chromosome: | chromosome 16 |
Location: | 337967 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g694208 | (1 of 1) IPR001965//IPR011011//IPR019787//IPR028941 - Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // Zinc finger, PHD-finger // WHIM2 domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTTGAGGGAAACACAGATGGGCCCTTCCGGGGCGCGCACGCTCTTCC |
Internal bar code: | CGTGTTAGAAACATCGCGAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1559 |
LEAP-Seq percent confirming: | 83.7209 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATGACCCGTCGCTCATTGG |
Suggested primer 2: | CTGTCCCATCACACACCCTC |