| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.068146 |
| Chromosome: | chromosome 1 |
| Location: | 7418821 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g052300 | E2F1 | (1 of 1) K06620 - transcription factor E2F3 (E2F3); Transcription factor, E2F and DP-related | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCAAAACTACAGTAACACCGTCGTTTAAGGGCTATGCGCCGCGGCCA |
| Internal bar code: | ATCAGTCAATACGTGTGTATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2448 |
| LEAP-Seq percent confirming: | 98.1818 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCACTGTGGAACTTGTG |
| Suggested primer 2: | GGCCGAGGATTCATTAGCGA |