| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.068223 |
| Chromosome: | chromosome 12 |
| Location: | 3834103 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514950 | CGLD17,HEL53 | (1 of 1) PTHR12873//PTHR12873:SF0 - T7-LIKE MITOCHONDRIAL DNA HELICASE // TWINKLE PROTEIN, MITOCHONDRIAL; Conserved in the Green Lineage and Diatoms | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGCGGGTGCAAGGGACCAA |
| Internal bar code: | CGTTCCAATCATGAGTCTCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1180 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCCTCCTCCTCTTCCTCC |
| Suggested primer 2: | CCCGTCTGTGTACAAACCGA |