| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.068242 |
| Chromosome: | chromosome 1 |
| Location: | 5344675 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037600 | (1 of 1) K12418 - fatty acid desaturase (delta-4 desaturase) [EC:1.14.19.-] (K12418) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGCTGGGCATCGCTGTCGGCTGTGCTGGTGGCCGCGGCGGTGGCATG |
| Internal bar code: | TCTCTGCAGCTCTTATTTCCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6069 |
| LEAP-Seq percent confirming: | 4.65116 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGCTGCCATCAAACATAG |
| Suggested primer 2: | TTGATGCTGGCAGTGGAGTT |