Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.068248 |
Chromosome: | chromosome 7 |
Location: | 2639583 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g330450 | uL24m,MRPL24 | Mitochondrial ribosomal protein L24; (1 of 2) K02895 - large subunit ribosomal protein L24 (RP-L24, MRPL24, rplX) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCGGTGGCTAGCTCTTGACTACGCGCTACATGGCTATGCAGCGCTGTC |
Internal bar code: | TGAAATTCAGATTCATGTGTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 6291 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 83 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCATATTCGTTGCAAGGCCG |
Suggested primer 2: | GAAGATCTGTTGGAGCGGCT |