| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.068279 |
| Chromosome: | chromosome 11 |
| Location: | 1894229 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467785 | (1 of 3) PTHR10625:SF102 - HISTONE DEACETYLASE 10 | 5'UTR | |
| Cre11.g467786 | (1 of 1) 1.14.13.15 - Cholestanetriol 26-monooxygenase / Vitamin D(3) 25-hydroxylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGTTACATAGTCGTTTATGCAGTCAACGTCGGTGCGGCGAGCTGCCCT |
| Internal bar code: | TTCTTAAGGGCGCTAGTGGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 741 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGCTCGCTATGGTTTTC |
| Suggested primer 2: | ATCATCTGCTCCGCACTCAG |