| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.068310 |
| Chromosome: | chromosome 10 |
| Location: | 3216558 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g442200 | ERG6,ERG26 | 3-beta hydroxysteroid dehydrogenase/epimerase; (1 of 2) K07748 - sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) (E1.1.1.170, NSDHL, ERG26) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCAGTGATCACCGGTCCACCGCCCGCCGTGAACCTTGCACACACGCTG |
| Internal bar code: | GGTGCAAGGCAAATAACCTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2479 |
| LEAP-Seq percent confirming: | 54.5455 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTACCACATCACACACGA |
| Suggested primer 2: | CAGGATATCGAACCGCACGA |