| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.068346 |
| Chromosome: | chromosome 12 |
| Location: | 3521655 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g496650 | (1 of 5) PF04116 - Fatty acid hydroxylase superfamily (FA_hydroxylase) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGTGCGGACACATGGGATGCAACCTTGGTGGAGGTATGGAGCCACGG |
| Internal bar code: | CTTGCGGCTATCGTACATTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2760 |
| LEAP-Seq percent confirming: | 96.8254 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTTGCCTTGCACATGAC |
| Suggested primer 2: | ATAAGGACCACAGCAAGGGC |