| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.068350 |
| Chromosome: | chromosome 12 |
| Location: | 7440871 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557000 | ATG12,APG12 | Autophagy-related protein; (1 of 1) K08336 - ubiquitin-like protein ATG12 (ATG12) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGCTCATTCGTCGTGGGGCGTAGTTCACCTGTTAGCAAAATTGCAG |
| Internal bar code: | TCGGAATTCTCCACGTACCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1625 |
| LEAP-Seq percent confirming: | 39.2857 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGAGTACACCCAGGCTAT |
| Suggested primer 2: | CACATCAGACCCTTCCACCC |