| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.068359 |
| Chromosome: | chromosome 6 |
| Location: | 2541911 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g269450 | EIF3G | Eukaryotic translation initiation factor 3, subunit G; (1 of 1) K03248 - translation initiation factor 3 subunit G (EIF3G) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGCTGCAGCTCGGCGCCGCGAAGTCAGTAGCAGCCATCGGCATGGGGG |
| Internal bar code: | TGATCAAGTATAGGCCTCCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2133 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGATCACTGACCATGGCA |
| Suggested primer 2: | CCTGCCAGAGATGACGGTTT |