| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.068372 |
| Chromosome: | chromosome 14 |
| Location: | 3665118 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631200 | IC97,FAP94,DII6 | (1 of 1) K17580 - cancer susceptibility candidate protein 1 (CASC1); Flagellar Inner Arm Dynein I1/f intermediate chain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCAGGGGAACCCCTGTCTCCCGCCGTCAACACCCATAGATACAGCCC |
| Internal bar code: | GCAAGGTTTAGACTTGCAGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 896 |
| LEAP-Seq percent confirming: | 81.8182 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCAGCCGGTAGTTAGCCT |
| Suggested primer 2: | GGTCCCACGAAGTTTTGCAC |