| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.068452 |
| Chromosome: | chromosome 16 |
| Location: | 4480237 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667729 | 3'UTR | ||
| Cre16.g667750 | RPB7,RPB7A | (1 of 1) K03015 - DNA-directed RNA polymerase II subunit RPB7 (RPB7, POLR2G); DNA-directed RNA polymerase II, 19 kDa polypeptide | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCTGCCAAGGCCGCCTCTCCCGCCGGCAAGGCCGCCTCTCCCGCTG |
| Internal bar code: | CGGACGCAACCAAACATTTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1268 |
| LEAP-Seq percent confirming: | 6.66667 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGAAGTGGTGAGTGCGT |
| Suggested primer 2: | GCAGGTTGGTGAAGTCCGTA |