| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.068534 |
| Chromosome: | chromosome 1 |
| Location: | 5946399 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g042300 | SRR6 | (1 of 1) IPR001190//IPR009003//IPR017448 - SRCR domain // Peptidase S1, PA clan // SRCR-like domain; Scavenger receptor cysteine rich (SRCR) protein | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCATCTAAATCCTTCATTCTTGACTCCAATACGATGTACTTGTGAGGG |
| Internal bar code: | GGTCCGCCCACTGGAAACTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 691 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTTTGACGTCGATGGCGA |
| Suggested primer 2: | CATCGTGCTGTAATGGCGTG |