| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.068543 |
| Chromosome: | chromosome 12 |
| Location: | 9871000 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544327 | (1 of 37) PF13639 - Ring finger domain (zf-RING_2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGATAGTTGCTGCGCGCGAGCCCGCAGTGCTTCGCCTTCAAAGAGGA |
| Internal bar code: | TAGCTAACAAGTTTCTCGTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3555 |
| LEAP-Seq percent confirming: | 58.5366 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGCGAAAACCACGGAATC |
| Suggested primer 2: | GCAAGCGCTATCACAGTTGG |