| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.068554 |
| Chromosome: | chromosome 2 |
| Location: | 3947443 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g102250 | RPS3 | Cytosolic 80S ribosomal protein S3; (1 of 1) K02985 - small subunit ribosomal protein S3e (RP-S3e, RPS3) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAATTATGACACGCGGTTTGAGCTCCCCCCTAGCCACCCCGCATAGGA |
| Internal bar code: | GACCAAGCAGTTTCTTATCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1181 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCACCAACTACGAGGTCAA |
| Suggested primer 2: | TTGAAGCGCTTCTGCACAAC |