Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.068601 |
Chromosome: | chromosome 12 |
Location: | 7219501 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g559053 | CSB50 | {"Probable transposon-derived protein of Chlamydomonas-Specific family B; (1 of 20) IPR010095//IPR013083 - Transposase IS605, OrfB, C-terminal // Zinc finger, RING/FYVE/PHD-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCCAACCGGCCACGTCCGGATTTGCGGGGATGCCAAAGGCCCCCAA |
Internal bar code: | ACTGCCACATAACGATACCGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1929 |
LEAP-Seq percent confirming: | 95.8333 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGCTGCAAGACAAAGACG |
Suggested primer 2: | GATCCTCCTCATGGCTGCTC |