| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.068612 |
| Chromosome: | chromosome 6 |
| Location: | 7437173 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300550 | TIC100 | (1 of 14) PF02493 - MORN repeat (MORN); 100 kDa subunit of translocon at the inner membrane of chloroplasts | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGCACGGCAGCGCGGGGCATGGGGCGTGCAAGCACTACAGCCGCGG |
| Internal bar code: | AAGCCCCAATGAACTGCCGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2472 |
| LEAP-Seq percent confirming: | 24.4444 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTAAACCTCCACGGAAC |
| Suggested primer 2: | ACATCCCCGAGATCCTGTGA |