| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.068627 |
| Chromosome: | chromosome 4 |
| Location: | 3860375 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g230242 | MOT40 | (1 of 1) IPR007914//IPR015422 - Uncharacterised protein family UPF0193 // Pyridoxal phosphate-dependent transferase, major region, subdomain 2; Predicted protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCACCACACACCTCCTCGCTATGCCGGCTCCTGCCCCCGCGAGCTCAA |
| Internal bar code: | CGTAGAGATTTCGCTGGCACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 594 |
| LEAP-Seq percent confirming: | 76.1905 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAAGCTGGAGACTGTGCA |
| Suggested primer 2: | GACCTCCTTGATTGCTGGCT |