Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.068637 |
Chromosome: | chromosome 3 |
Location: | 7899228 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g202500 | (1 of 1) PF04836//PF05004 - Interferon-related protein conserved region (IFRD_C) // Interferon-related developmental regulator (IFRD) (IFRD) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGGCAGTGCCATGGAGAGCAGTCTGGCCTCGCAGCTGCTGGGGCTGC |
Internal bar code: | GGCCCCACGCTGGTTCACAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 886 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 28 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCACTAGCCTTGCTCCTTC |
Suggested primer 2: | GGGATGCTGATGACGACGAT |